Primer Melting Temperature (Tm) Calculator
Compute primer melting temperature with the SantaLucia nearest-neighbor model and a salt correction. Paste one or many primers to get the melting temperature, GC content, and thermodynamics, with the Wallace and GC-percentage formulas for comparison.
3 primers · one sequence per line
Typical PCR buffer is 50 mM.
Typical oligo is 200 to 500 nM.
| Primer | Len | GC% | Tm (NN) | Wallace | GC% formula |
|---|---|---|---|---|---|
| GTAAAACGACGGCCAGT | 17 | 53 | 51.6°C | — | 41.9°C |
| CAGGAAACAGCTATGAC | 17 | 47 | 46.0°C | — | 39.5°C |
| GCGTAATACGACTCACTATAGGG | 23 | 48 | 54.2°C | — | 50.2°C |
First primer thermodynamics
Why the Nearest-Neighbor Model Is the Standard for Primer Tm
A primer's melting temperature governs whether a polymerase chain reaction works, because it sets the temperature window where the primer binds its target without binding everything else. The single most important idea in modern Tm prediction is base stacking: the stability of a duplex depends not just on how many G-C and A-T pairs it has, but on which bases sit next to each other. The nearest-neighbor model of SantaLucia (1998) captures this with measured enthalpy and entropy values for each adjacent base-pair step.
Older shortcuts miss this. The Wallace rule, Tm = 2(A+T) + 4(G+C), treats each base independently and is only reasonable for oligos under about 14 bases. A GC-percentage formula adds a length and salt term but still ignores sequence context. This calculator shows all three side by side so you can see how far the approximations drift from the nearest-neighbor value as primers get longer.
Reaction conditions matter as much as sequence. Monovalent cations shield the phosphate backbone and raise the Tm, so the model applies a salt correction to the entropy term, and the primer concentration enters the thermodynamic equation directly. Because the Tm depends on GC content, pairing this tool with the GC content calculator helps you understand why one primer runs hotter than another, and the reverse complement tool builds the reverse primer from the target.
In practice, aim for paired primers with matched Tms and set an annealing temperature a few degrees below the lower Tm, then optimize. The nearest-neighbor Tm gives the reliable starting point. For assays and experiments where primer design is one step in a larger analysis, from expression quantification to variant work, the bioinformatics analysis service handles the full pipeline with reproducible methods.
How to Use This Calculator
Paste your primers
One primer per line. Paste a whole set to compare the forward and reverse Tms together.
Set the conditions
Adjust sodium and primer concentration to match your reaction; defaults reflect a standard PCR buffer.
Read the nearest-neighbor Tm
The recommended Tm sits beside GC content, the Wallace rule, and the GC-percentage formula.
Match and export
Check paired primers agree within about 5 degrees, then export the table as a CSV.
Next step
Primer checked. Want a PhD on the whole study?
Assay design support plus the full biological-data analysis and publication-ready reporting, handled by a PhD statistician.
Our promise: Free pipeline re-run and figure revisions if reviewers push back.
Timeline
Most projects deliver in under 2 weeks. We confirm an exact date in your quote.
If reviewers push back
If reviewers question the pipeline, parameters, or figures, we re-run the analysis and revise free.
Confidentiality
NDA available on request before any project discussion. Your data, study design, and manuscript stay private either way.
Want a PhD methodologist to handle the whole project?
Get a complete primer-design and assay-validation support alongside your biological-data analysis. Free pipeline re-run and figure revisions if reviewers push back. Pay only after you approve your quote.
Frequently Asked Questions
What is the melting temperature of a primer?
The melting temperature (Tm) of a primer is the temperature at which half of the primer molecules are annealed to their complementary template and half are single-stranded. It depends on the primer length, its GC content, and the salt and primer concentrations in the reaction. A higher GC content and a longer primer raise the Tm because more and stronger base-pair interactions must be broken. This calculator reports the nearest-neighbor Tm, the most accurate estimate for oligos.
How do you calculate primer Tm?
The recommended method is the nearest-neighbor model (SantaLucia 1998), which sums experimentally measured enthalpy and entropy values for each adjacent base-pair step, adds initiation terms, and applies a salt correction, then solves the thermodynamic equation for Tm. Simpler formulas exist: the Wallace rule, Tm = 2(A+T) + 4(G+C), works for short oligos under 14 bases, and a GC-percentage formula is common for longer ones. This tool shows all three so you can compare.
What is a good Tm for a PCR primer?
Most PCR primers are designed for a Tm between 55 and 65 degrees Celsius, and the two primers in a pair should have Tms within about 5 degrees of each other so they anneal efficiently at the same temperature. Primers with a Tm that is too low anneal weakly and lose specificity, while a Tm that is too high can require impractical cycling conditions. This calculator lets you paste a whole primer set at once to check that the pair is matched.
What is the difference between Tm and annealing temperature?
The Tm is a thermodynamic property of the primer-template duplex, while the annealing temperature is the temperature you actually set in the thermocycler. A common starting point is to set the annealing temperature about 3 to 5 degrees Celsius below the lower primer Tm, then optimize empirically. The Tm predicts behaviour; the annealing temperature is the experimental setting you tune from it.
Why does salt concentration affect the melting temperature?
Monovalent cations such as sodium and potassium shield the negative charges on the DNA phosphate backbone, stabilizing the duplex and raising the Tm. The nearest-neighbor model corrects the entropy term for salt concentration, which is why this calculator lets you set the sodium concentration; the default of 50 mM reflects a standard PCR buffer. Magnesium and other divalent ions also raise Tm but are handled by more specialized models.
Why is the nearest-neighbor method more accurate than the Wallace rule?
The Wallace rule assigns a fixed contribution to each base regardless of its neighbours, so it ignores base stacking, the dominant stabilizing force in a duplex. The nearest-neighbor model instead uses measured thermodynamic parameters for each of the ten unique adjacent base-pair steps, plus initiation and salt terms, capturing how stability depends on sequence context. For any primer longer than a few bases, the nearest-neighbor Tm is substantially more reliable.
Related Sequence Tools
To understand why GC content drives melting temperature, use the GC content calculator. To build a reverse primer from your target, the reverse complement tool reconstructs the opposite strand. To confirm a primer sits in the intended coding region, the DNA to protein translation tool reads the reading frames. For assay design as part of a full study, the bioinformatics analysis service covers the complete pipeline.
Reviewed by
Dr. Sarah Mitchell
Dr. Sarah Mitchell holds a PhD in Biostatistics from Johns Hopkins Bloomberg School of Public Health and has over 15 years of experience in systematic review methodology and meta-analysis. She has authored or co-authored 40+ peer-reviewed publications in journals including the Journal of Clinical Epidemiology, BMC Medical Research Methodology, and Research Synthesis Methods. A former Cochrane Review Group statistician and current editorial board member of Systematic Reviews, Dr. Mitchell has supervised 200+ evidence synthesis projects across clinical medicine, public health, and social sciences. She reviews all Research Gold tools to ensure statistical accuracy and compliance with Cochrane Handbook and PRISMA 2020 standards.
The Tool Is Free. The Full Analysis of Your Biological Data? We Handle That.
Our PhD statisticians run the complete pipeline: differential expression with multiple-testing correction, survival modelling, dimensionality reduction, and publication-ready figures with a reproducible methods section. Constant pricing, most projects delivered in under two weeks.
Our promise: Free pipeline re-run and figure revisions if reviewers push back.
The methodologists behind your review
Your project is led by a named PhD methodologist with real credentials and published work.
4.9 / 5 across 1,194+ delivered projects
