Primer Melting Temperature (Tm) Calculator
Compute primer melting temperature with the SantaLucia nearest-neighbor model and a salt correction. Paste one or many primers to get the melting temperature, GC content, and thermodynamics, with the Wallace and GC-percentage formulas for comparison.
3 primers · one sequence per line
Typical PCR buffer is 50 mM.
Typical oligo is 200 to 500 nM.
Typical PCR is 1.5 to 3 mM. Leave 0 to ignore.
dNTPs bind magnesium; typical total is 0.8 mM.
| Primer | Len | GC% | Tm (NN) | Anneal Ta | Wallace | GC% formula |
|---|---|---|---|---|---|---|
| GTAAAACGACGGCCAGT | 17 | 53 | 51.6°C | 46.6°C | — | 41.9°C |
| CAGGAAACAGCTATGAC | 17 | 47 | 46.0°C | 41.0°C | — | 39.5°C |
| GCGTAATACGACTCACTATAGGG | 23 | 48 | 54.2°C | 49.2°C | — | 50.2°C |
First primer thermodynamics
Primer pair (first two primers)
The two melting temperatures differ by more than 5 °C. Unbalanced primers amplify with different efficiency; consider redesigning one so the pair is within about 5 °C.
Secondary structure of the first primer
Self-dimer
5'-GTAAAACGACGGCCAGT-3'
|| | | ||
3'- TGACCGGCAGCAAAATG-5'Hairpin
No stable hairpin predicted.
Cross-dimer with the second primer
5'- GTAAAACGACGGCCAGT-3'
| | | || |
3'-CAGTATCGACAAAGGAC-5'Why the Nearest-Neighbor Model Is the Standard for Primer Tm
A primer's melting temperature governs whether a polymerase chain reaction works, because it sets the temperature window where the primer binds its target without binding everything else. The single most important idea in modern Tm prediction is base stacking: the stability of a duplex depends not just on how many G-C and A-T pairs it has, but on which bases sit next to each other. The nearest-neighbor model of SantaLucia (1998) captures this with measured enthalpy and entropy values for each adjacent base-pair step.
Older shortcuts miss this. The Wallace rule, Tm = 2(A+T) + 4(G+C), treats each base independently and is only reasonable for oligos under about 14 bases. A GC-percentage formula adds a length and salt term but still ignores sequence context. This calculator shows all three side by side so you can see how far the approximations drift from the nearest-neighbor value as primers get longer.
Reaction conditions matter as much as sequence. Monovalent cations shield the phosphate backbone and raise the Tm, so the model applies a salt correction to the entropy term, and the primer concentration enters the thermodynamic equation directly. Because the Tm depends on GC content, pairing this tool with the GC content calculator helps you understand why one primer runs hotter than another, and the reverse complement tool builds the reverse primer from the target.
In practice, aim for paired primers with matched Tms and set an annealing temperature a few degrees below the lower Tm, then optimize. The nearest-neighbor Tm gives the reliable starting point. For assays and experiments where primer design is one step in a larger analysis, from expression quantification to variant work, the bioinformatics analysis service handles the full pipeline with reproducible methods.
A Worked Example: Matching a Primer Pair
Consider a forward and reverse primer for one amplicon, each 20 bases, at the default 50 millimolar sodium and 0.25 micromolar primer concentration. The nearest-neighbor melting temperatures come out close together, which is what you want: a pair whose Tms differ by more than about 5 degrees will not anneal efficiently at a single temperature.
| Primer (5' to 3') | GC | Nearest-neighbor Tm | Salt-adjusted GC% Tm |
|---|---|---|---|
| ACGTCCATGGAGCTGAAGTC | 55% | 56.2 °C | 48.7 °C |
| GATCGTACGGATCCTTGACA | 50% | 53.3 °C | 46.7 °C |
The two nearest-neighbor Tms are 56.2 and 53.3 degrees Celsius, a difference of under 3 degrees, so the pair is well matched. A sensible starting annealing temperature is about 5 degrees below the lower Tm, roughly 48 degrees Celsius, to optimize from there. Notice the last column: the salt-adjusted GC-percentage formula reads about 7 degrees cooler than the nearest-neighbor value for the same primers. That gap is exactly why you should pick one method and not compare a Tm from one calculator against a threshold set with another.
Common Mistakes When Calculating Primer Tm
- Mixing Tm values from different formulas. The nearest-neighbor, Wallace, and GC-percentage methods can disagree by several degrees for the same primer. Comparing a nearest-neighbor Tm against an annealing rule tuned for a GC-percentage Tm sends the reaction to the wrong temperature. Stay within one method.
- Using the Wallace rule on long primers. The 2(A+T) + 4(G+C) rule is only reasonable below about 14 bases because it ignores base stacking. For a typical 20-mer it drifts well off the true Tm; use the nearest-neighbor value instead.
- Ignoring salt and primer concentration. Tm depends on the monovalent cation and oligo concentrations, so a value computed at a default buffer may not match your reaction. Magnesium, which also raises Tm, is not captured by a monovalent-only correction and needs a specialized model.
- Designing a mismatched pair. If the forward and reverse Tms differ by more than about 5 degrees, one primer anneals well and the other poorly at any single temperature, hurting specificity or yield. Adjust length or placement until the pair agrees.
- Judging a primer on Tm alone. A perfect Tm does not rescue a primer that forms a hairpin, self-dimerizes, or lacks a 3' anchor. Check secondary structure and the 3' end alongside the melting temperature before ordering.
How to Use This Calculator
Paste your primers
One primer per line. Paste a whole set to compare the forward and reverse Tms together.
Set the conditions
Adjust sodium and primer concentration to match your reaction; defaults reflect a standard PCR buffer.
Read the nearest-neighbor Tm
The recommended Tm sits beside GC content, the Wallace rule, and the GC-percentage formula.
Match and export
Check paired primers agree within about 5 degrees, then export the table as a CSV.
Next step
Want a PhD on the whole study?
Assay design support plus the full biological-data analysis and publication-ready reporting, handled by a PhD statistician.
Our promise: Free pipeline re-run and figure revisions if reviewers push back.
Timeline
Most projects deliver in under 2 weeks. We confirm an exact date in your quote.
If reviewers push back
If reviewers question the pipeline, parameters, or figures, we re-run the analysis and revise free.
Confidentiality
NDA available on request before any project discussion. Your data, study design, and manuscript stay private either way.
Want a PhD methodologist to handle the whole project?
Get a complete primer-design and assay-validation support alongside your biological-data analysis. Free pipeline re-run and figure revisions if reviewers push back. Pay only after you approve your quote.
Frequently Asked Questions
What is the melting temperature of a primer?
The melting temperature (Tm) of a primer is the temperature at which half of the primer molecules are annealed to their complementary template and half are single-stranded. It depends on the primer length, its GC content, and the salt and primer concentrations in the reaction. A higher GC content and a longer primer raise the Tm because more and stronger base-pair interactions must be broken. This calculator reports the nearest-neighbor Tm, the most accurate estimate for oligos.
How do you calculate primer Tm?
The recommended method is the nearest-neighbor model (SantaLucia 1998), which sums experimentally measured enthalpy and entropy values for each adjacent base-pair step, adds initiation terms, and applies a salt correction, then solves the thermodynamic equation for Tm. Simpler formulas exist: the Wallace rule, Tm = 2(A+T) + 4(G+C), works for short oligos under 14 bases, and a GC-percentage formula is common for longer ones. This tool shows all three so you can compare.
What happens if primer melting temperature is too high?
A very high primer melting temperature forces you to use a high annealing temperature, and if the annealing temperature is too high the primer binds its template weakly or not at all, so the reaction yields little or no product. A high Tm usually comes from a long primer or a high GC content, which can also promote stable secondary structure and non-specific binding. The practical fix is to shorten the primer or reposition it to a less GC-rich window so the Tm falls back into the workable 55 to 65 degree Celsius band.
Should annealing temperature be 5 degrees lower than primer melt temperature?
The classic starting rule is to set the annealing temperature about 3 to 5 degrees Celsius below the lower of the two primer melting temperatures, and it is a good first guess rather than a fixed law. Some workflows instead run a temperature gradient to find the optimum empirically, and high-fidelity polymerases often come with their own recommended offset. Use the minus-5 rule to pick a starting point, then optimize: too low an annealing temperature costs specificity, too high costs yield.
What is a good melting temperature for primers?
Most PCR primers are designed for a Tm between 55 and 65 degrees Celsius, and the two primers in a pair should have Tms within about 5 degrees of each other so they anneal efficiently at the same temperature. Primers with a Tm that is too low anneal weakly and lose specificity, while a Tm that is too high can require impractical cycling conditions. This calculator lets you paste a whole primer set at once to check that the pair is matched.
Why is annealing at 55 degrees?
Fifty-five degrees Celsius is a common default because it sits a few degrees below the 58 to 62 degree melting temperature that typical 18 to 25 base primers with 40 to 60% GC content are designed to have, which is stringent enough for specificity yet permissive enough for good yield. It is a convention, not a requirement: the right annealing temperature depends on your actual primer Tm, so compute the Tm first and set the annealing temperature relative to it rather than defaulting to 55 for every reaction.
What is the difference between Tm and annealing temperature?
The Tm is a thermodynamic property of the primer-template duplex, while the annealing temperature is the temperature you actually set in the thermocycler. A common starting point is to set the annealing temperature about 3 to 5 degrees Celsius below the lower primer Tm, then optimize empirically. The Tm predicts behaviour; the annealing temperature is the experimental setting you tune from it.
Why does salt concentration affect the melting temperature?
Monovalent cations such as sodium and potassium shield the negative charges on the DNA phosphate backbone, stabilizing the duplex and raising the Tm. The nearest-neighbor model corrects the entropy term for salt concentration, which is why this calculator lets you set the sodium concentration; the default of 50 mM reflects a standard PCR buffer. Magnesium and other divalent ions also raise Tm but are handled by more specialized models.
Why is the nearest-neighbor method more accurate than the Wallace rule?
The Wallace rule assigns a fixed contribution to each base regardless of its neighbours, so it ignores base stacking, the dominant stabilizing force in a duplex. The nearest-neighbor model instead uses measured thermodynamic parameters for each of the ten unique adjacent base-pair steps, plus initiation and salt terms, capturing how stability depends on sequence context. For any primer longer than a few bases, the nearest-neighbor Tm is substantially more reliable.
Related Sequence Tools
To understand why GC content drives melting temperature, use the GC content calculator. To build a reverse primer from your target, the reverse complement tool reconstructs the opposite strand. To confirm a primer sits in the intended coding region, the DNA to protein translation tool reads the reading frames. For assay design as part of a full study, the bioinformatics analysis service covers the complete pipeline.
Reviewed by
Dr. Sarah Mitchell
Dr. Sarah Mitchell holds a PhD in Biostatistics from Johns Hopkins Bloomberg School of Public Health and has over 15 years of experience in systematic review methodology and meta-analysis. She has authored or co-authored 40+ peer-reviewed publications in journals including the Journal of Clinical Epidemiology, BMC Medical Research Methodology, and Research Synthesis Methods. A former Cochrane Review Group statistician and current editorial board member of Systematic Reviews, Dr. Mitchell has supervised 200+ evidence synthesis projects across clinical medicine, public health, and social sciences. She reviews all Research Gold tools to ensure statistical accuracy and compliance with Cochrane Handbook and PRISMA 2020 standards.
The Tool Is Free. The Full Analysis of Your Biological Data? We Handle That.
Our PhD statisticians run the complete pipeline: differential expression with multiple-testing correction, survival modelling, dimensionality reduction, and publication-ready figures with a reproducible methods section. Constant pricing, most projects delivered in under two weeks.
Our promise: Free pipeline re-run and figure revisions if reviewers push back.